Home BLAST Help About  

MYOZ2 (Myozenin 2-like Protein)

Organism
Danio rerio (Zebrafish)
Phylogeny
Paralogs
MYOZ-2aI,
NM_200899.1
MYOZ-2aII,
Citations
  • Parmar MB., Wright JM. (2013). Comparative evolutionary genomics of medaka and three-spined stickleback fabp2a and fabp2b genes with fabp2 of zebrafish. Genome 56(1):27-37. doi:10.1139/gen-2012-0140.
  • Sarropoulou E., Moghadam HK., Papandroulakis N., De la G├índara F., Ortega Garcia A., Makridis P. (2014). The Atlantic Bonito (Sarda sarda, Bloch 1793) Transcriptome and Detection of Differential Expression during Larvae Development. PLoS ONE 9(2):e87744. doi:10.1371/journal.pone.0087744
  • Fish-it
  • Sequence
    >NM_200899.1 Danio rerio Myozenin-2a Protein
    CACAACTGACCCAGCACAGACAGCATGTCTCAGCATAGTCTGATGTCAACACAGGAGAGGAAAATGCAGGCAGCGGCTAT
    TTGTAGAGAGATCCACGCCAACGAAGAAGCAGAGATGGATCTGGGGAAGAAAGTCAGCGCACCAAAGGAGATCATGTTGG
    AGGAGCTTTCCCTGGCCTCAAACAGGGGCTCACGTCTCTTCAAGATGCGTCAGAAGCGCTCAGAGAAATACACATTTGAG
    AGTATTCAGAATGAAGTCAACGTACAGCACAGTACTGATGCTGTTTTTCCTGGTCCATGTGCTGAGATGACAAACATTTT
    AAGTGATGAAAACTGTCTTGGAGTTGATCAGGCACCAAATCCACTCAATCCTGACAACATCGCTCCAGGTTACGGTGGTC
    CCTTGAAGGATGTTCCAGCAGAGAAGTTCAACTGTACAGCTATGCCCAAATCCTACCAGTCTCCTTGGGAGCAGGCCCTC
    ACCAGTGACCCTGCCCTGGCCCAAACACTGCTGGCCCGCGTCCCTGAACCTGAGAGCAAACAGCAGATCCCACAGTACAA
    GAGCTTCAACAGGGTGGCTATTCCATTCGGCGGCTTCGGCAAGGCTCCCAAAGTCCCTGTTAAAGCTGTAGATTCGGATC
    CAGAACTCGTCGTTCCTCGTCCCGCAGCTGAAGTCCCTGCTATTGTCAAACGACCCACCTTCAACAGGACGGCCTCAGGA
    TGGGTCACCGACAGCGCCCCTCTGACCTTTCCCAGCATCCCTCTGGAGCCCATTTCATCCATGTCTTCCACATTCATCCC
    CGAGTCTGATGACCTCTGAACCTCAGCCTTGTTTACATGAGCATGTCTCTTGTTCATTACCATGGGGGAATATTTTTTAA
    TGTCTTTGCAAGAAGACTTGATGATCAAAAACGATTTATTATTAATAACAAAAACTTTTTCCTTTGGTTGAAGCCACAAA
    ATGATGAAAAAACATCTGGCTGGTAGTGTAAAGCAGAGGTGTACACTGTATAACGGAGTAAATTTAGCATAATGAGAAAC
    AAAGTAAGTAAAGCTTTAAAGGGATATATGTGACTGATTTCTGTTTTAGAAATGTCCATCTGAACCAATTCACAAAGCTG
    AAGGAGAGCTTTAGAAAGAGTTTGTTCATATAGACCTGTAAATATGTATTTATGAAGGGCTGTGACATCGATTTATTTAA
    ATTATTGAATACAGAAAACATTCACTGAACTTGTGTTTCCGTTAGAGTATTTTTAATTTACATTTAATAAATTACACTCA
    AAATACTTTTCTTTATAAGTTCATGCTCTAAAATTATTTACAAATGTTTTTTGATTCTCTGATTTTTTTGTTTGTTTGTT
    TTGAAGCAAATAAAATAAATAAATAAATAAATCTATTTCACAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
    AAAAAAAAAAA

    Send to
    or


    >XM_005170915 Danio rerio Myoz-2aII ATGTCACAGTTCAGCACTCTTTCAGTGCGTGAGAGGAAGATG
    CAGGCAGCTGCCCTTTGCCATGAGGTCCATGGTGGTGTCAACGGTGTTACTATGGACCTGGGAAAGAAACTTTCCACCCC
    AAAAGACATCATGCTGGAGGAACTTTCCCTCTTGTCAAACCGTGGATCACGTCTTTTTAAAATGCGACAACGGAGGTCAG
    ACAAATACACCTTTGAAAGCATTCAGAATGAAGCCAATGCGCTTTTTAATAATGAAAATCAAGCTAATGCTGAAAACTCA
    GAAAACAAAGGAGTTGCATCAAAAACTCCACCAAATACACCAGATCCCAGAAACCCAGCGAACCCTGAGGACATTGCACC
    AGGATATGGAGGTCCTTTGACAAACATTCCTCCAGAGAGGTTTAATGCCACAGCTATGCCCAAATCCTACCACTCCCCCT
    GGGAAGAGGCCATCATCAATGACCCCACACTGGCTGACACACTTAAAGTTCACATGCCAGTGCCTGAACCGAAAGTAGAG
    CTGCCTGACTACAAAAGCTTTAATAGGGTTGCTACACCATTTGGCGGTTTCGAAAAAGCTCCACGAGGAATCACCTTTAA
    GCTTCCAGAGATGGACTTGAATACTCCTCAATACCCTGAGCTTCAGGATCATTCAGCCAAGCGGCCCACTTTCAACAGGA
    CAGCCCAGGGGTGGATCTCTGAAGGCACACCTTTAATTTTACCCACCGTCTCTCTGGAGCCTTTTGAGATCCCTGAGTCT
    GATGATCTGTAA

    Send to
    or


    >XM_005170915.2 Danio rerio Myozenin 2-like b Protein
    ACACCCCCACCTCAGTGTAAGTCAAGAACAGAGTGTGAGACAAAGACAAATCTGGCCGGATCGATCTACCTAAAGTAACC
    TCTTGCTTTGTACAGGTACTGAACTGAAGAAAACACGCAGCTCTAACAGCACCACTGGAATTCTGATTTAACGCAACATG
    TCACAGTTCAGCACTCTTTCAGTGCGTGAGAGGAAGATGCAGGCAGCTGCCCTTTGCCATGAGGTCCATGGTGGTGTCAA
    CGGTGTTACTATGGACCTGGGAAAGAAACTTTCCACCCCAAAAGACATCATGCTGGAGGAACTTTCCCTCTTGTCAAACC
    GTGGATCACGTCTTTTTAAAATGCGACAACGGAGGTCAGACAAATACACCTTTGAAAGCATTCAGAATGAAGCCAATGCG
    CTTTTTAATAATGAAAATCAAGCTAATGCTGAAAACTCAGAAAACAAAGGAGTTGCATCAAAAACTCCACCAAATACACC
    AGATCCCAGAAACCCAGCGAACCCTGAGGACATTGCACCAGGATATGGAGGTCCTTTGACAAACATTCCTCCAGAGAGGT
    TTAATGCCACAGCTATGCCCAAATCCTACCACTCCCCCTGGGAAGAGGCCATCATCAATGACCCCACACTGGCTGACACA
    CTTAAAGTTCACATGCCAGTGCCTGAACCGAAAGTAGAGCTGCCTGACTACAAAAGCTTTAATAGGGTTGCTACACCATT
    TGGCGGTTTCGAAAAAGCTCCACGAGGAATCACCTTTAAGCTTCCAGAGATGGACTTGAATACTCCTCAATACCCTGAGC
    TTCAGGATCATTCAGCCAAGCGGCCCACTTTCAACAGGACAGCCCAGGGGTGGATCTCTGAAGGCACACCTTTAATTTTA
    CCCACCGTCTCTCTGGAGCCTTTTGAGATCCCTGAGTCTGATGATCTGTAACACCAGTCCAACCCCAAACCCACTGAGCC
    TGATGGAAGTTTAAGGCTTTTGTAGATGTCCCCCATGTTAGCGTCTGATAACAGCCCAGTGTCATGTTTTATCAGTAAAT
    ATTGAACTTCTGTTCTTGGGACTAGTATTTTCACATATCATTTTTTAATGGATGCCAAATCAAAGAAAAAATGGATATCT
    AACAAGACAGTATCAAATGAGCAGCAGGAAATGAATCATTTTTAGTATCCATCACAGCATTACAAGTATTATTTACTGTA
    ATTTATTGATATATCCAAGGTGTTGATTTTAATGCTGTGCATGGTTATACTGTGAAACAGTTTTCTAAGGTTGCATTCAT
    CTTTATTAGTAAGTTTCATTTAGTACAGCATAAGATAATAGCTTGTTTTGCTCACATAAACAATCTTTGTAGTGTAAACA
    GCAACTCTTTGTCTAAAAGTAAAATTATTCATTTTAATCCTGTAATTAAATCTAATCTAATTTAATCAGGGATGAATCAA
    TGGAGGAAACAGCCATGTAAATATAATTTGTTGAGTGCCTGAAATATTGTTTTTACTGTTAAAAAAATACTACTATAGAT
    TTCTGTCTGAAACATTACATTCACTGTGTTAGAACTTGTACTGTAGCTTATAGAAATTAGTGTACCCAAACTGTGCAAAT
    AAAATGATGAATTATTTGA

    Send to
    or




    Organism

    Phylogeny (Gene Tree)

    Paralogs

    Citations

    Sequence


    Data input by Mara Iliopoulou and Elena Sarropoulou

    CLICK IMAGES
    FOR LARGER SIZE