Home BLAST Help About  

MYOZ2 (Myozenin 2)

Organism
Sparus aurata (Gilthead sea bream)
Phylogeny
Paralogs
MYOZ-2aI,
MYOZ-2aII,
MYOZ-2b
Sequencing Methods
MYOZ-2aI: Illumina paired end sequencing

MYOZ-2aII: Illumina paired end sequencing

MYOZ-2b: Illumina paired end sequencing
Citations
  • Sarropoulou E., Moghadam HK., Papandroulakis N., De la G├índara F., Ortega Garcia A., Makridis P. (2014). The Atlantic Bonito (Sarda sarda, Bloch 1793) Transcriptome and Detection of Differential Expression during Larvae Development. PLoS ONE 9(2):e87744. doi:10.1371/journal.pone.0087744
  • Fish-it
  • Sequence
    >SA_comp15913_c0_seq4_Myoz-2aI
    ATGGATCTTGGGAAGAAAGTGAGCGTGCCTAAGGACATCATGCTGGAGGAGCTGTCTTTTGCCTCAAACCGTGGCTCC
    CGTCTCTTCAAAATGCGCCAGAGACGCTCTGAAAAATACACTTTTGAGAGCATCCAGAATGAAAACAACAAGCAGCTCAA
    TAACACAGTGGTTTCTCAAACTGAGAATGGGAATGCCGCAGACAGCCACAGCGGCGAGAACAACTTGGGTGTCGACCAAC
    CACCTAAAGTGCCATCTGACACACCTAATACAACAATTGTGCCAAATCCAGACAGCATTGCCCCGGGGTACGGAGGTCCT
    TTGAAAGACATCCCTCCAGAGAAGTTCAACAGTACAGCTGTGCCGAAGTCCTACTTCTCACCCTGGCAGCAGGCCATCAT
    CAGTGACCCGGCCTTGGCTGACACTCTCATCACCTGCGTGCCCGAGCCAGAGCCCAGACCAGACCTTCCAGGTTACAAAA
    GTTTCAACAGGGTGGCAACTCCGTTCGGCGGCTTCAGCAAGGCACCCAGACCTGCTCCCATCAAGACCCTCCCGATGGAA
    CCCCTCCCCGACTATCCCGAGCTCCAGGGGGACACAGAGGCAGCAAATCGACCCTCCTTCAACAGATCTGCTCTGGGGTG
    GGTGTCGACAGGCGATCCTGTCCCTCTCCCTAGTGTTTCCCTTGAGCCTGTGCTCATCCCTGAGTCAGAAGACCTTTGAA
    CCCATAATGA

    Send to
    or


    >Sparus aurata MYOZ-2aII TR78323|c0_g1_i3
    ATGTCACAATTCTGTACAATGCCAATTGGACAGAGGAAGAAGTGTGCAGCAGCTATTTGCCAAGAGATCCATGGTACC
    AATGGGGACATAATGGATCTGGGAAAGAAACTCAGCACTCCTAAAGACATTATGTTGGAGGAGTTATCGTTGCTTTCCAA
    CAGAGGTTCGCGGCTTTTCAAGATGCGCCAGAGGAGATCTGAAAAATATACATTTGAAAGTATCCAAAATGAGGCAAATG
    CACAGCTAAATAATAATATTTTAACTGAGAATACACACTCTGTGGAAATTAAAGTGGATCCACCAGCTGATGGAAATGCT
    GCTAATCAAGAAAACACTGCTTCAGAGAACGCATCAGCTATTCTGAAGTCCTACCACTCCCCATGGGAACAGGCAATCCT
    CAGTGACCCCGACCTCGCTGAATCCCTCAAACTGACAATGCCAGCACCAGACCCAAGACCAGATCTCCCTGAGTACAGAT
    GCTTTAACAGGGTGGCTACTCCTTTTGGTGGCTTTGACAAAGCTCCCAGAGGAATCACATTCAAGCTCCCAGAGGTAGAC
    CTGAACCCGCCTAGTTACCCAGAACTGCAGGATCCAGGTGTGAAACGGCCCACCTTCAACAGGACAGCCCAGGGATGGAT
    ATCTGAGGGCACCCATCTGATCCTACCCACGATTACCTTGGAACCCATCAAAGTCCCAGAGTCTGACGACCTGTAG

    Send to
    or


    >SA-TR81020|c0_g2_i5_Myoz-2b
    ATGCAATCAGGCGTGGATGACATCACCAAGCAGAGGATGCTGCAGGCCAGGGCTCTGTCTCAGGAGGCCAGGGGAAAG
    GGTCTGAACCTGGGGAAGAAGATCAGCGTTCCAAAGGAAGTGATGATGGAGGAGCTGAATCTTCCGTCTAACCGAGGCTC
    CCGAATGTTTCAGGAGAGACAGAGGAGGGTGGAGAGGTACACGCTGGAGAACAGTGCCGACGGCGCTTACAACGTCCATC
    CAGAGGCCGTTCCTCCCCCGCAGATTATCCCAGAGCCACAGGGTGGAAAAGAGAACCAGGCTTTCTCCATCCCTGGATAC
    TCCCGCCCTCTGAAGGAAATTCCTCGCGAGAAATTCAACGCGACAGTCATCCCCAAATCCTACTGCTCCCCGTGGAGGGA
    AGCTTTGGGGGGCACAGAGGAGCTCCTGAGCACCCTCGATGCTCAACTGCCCCCGACCCCACGAAGAGCTTTCAACTACA
    GGTGCTTCAACAGATCCGCCATGCCATTCGGAGGGTCTATGGCCAGCAAGAGGGTGATCCCAGTGATTAGCTTTGAGGCA
    GTGGAGTCCCAGAAGCTGCCCGACATTGCTCAGAGCCGCTGGGTGCAGCGGCCCAACTTCAACAGAGCACCCAAGGGATG
    GGGAATGGATTACAGCCCGGAATCTAA

    Send to
    or




    Organism

    Phylogeny (Gene Tree)

    Paralogs

    Sequencing Methods

    Citations

    Sequence


    Data input by Elena Sarropoulou

    CLICK IMAGES
    FOR LARGER SIZE