Home BLAST Help About  

MYOZ2 (Myozenin 2-like Protein)

Organism
Oryzias latipes (Medaka)
Phylogeny
Paralogs
MYOZ-2aI,
XM_004082651
MYOZ-2aII,
XM_004084291
Sequencing Methods
MYOZ-2aI: NCBI: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_004088048.1) annotated using gene prediction method: Gnomon, supported by EST evidence. ENSEMBL database:ENSORLG00000017599

MYOZ-2aII: Downloaded from ENSEMBL

MYOZ-2b: BioProject: PRJNA183868
Citations
  • Sarropoulou E., Moghadam HK., Papandroulakis N., De la G├índara F., Ortega Garcia A., Makridis P. (2014). The Atlantic Bonito (Sarda sarda, Bloch 1793) Transcriptome and Detection of Differential Expression during Larvae Development. PLoS ONE 9(2):e87744. doi:10.1371/journal.pone.0087744
  • Fish-it
  • Sequence
    >XM_004082651 Oryzias latipes Myozenin-2aIProtein
    ATGTCTCGGTTCACCACCATGACAACAAGGGAAAGGAAAATGCAGGCGGCAGCAATCTGCAGGGAGGTGCATGCTCAG
    GATGAGTTTTCGATGGATCTTGGGAAGAAAATGAGCGTGCCCAAAGACATCATGCTCGAGGAGCTTTCCCTTGCCTCCAA
    CCGTGGGTCCCGACTCTTCAAACTGCGCCAGAGACGCTCAGAAAAGTACACTTTTGAGAATGTCCACAATCAAAACAACA
    TGCAATTAAATAACAACGCAATTCCTAAGTCTGAGAATGAGACTACCACATTCACCAACGGCAACGAGGACAACTCTAGA
    ACCAACCAACCATATAAAGTCACAATTGACACACTGGACACAAAAATGATACCAAACCCAGGCATTATTGCTCCAGGATA
    TGGAGGTCCTTTGAAAGACATCCCTCCAGAGAAGTTTAACAGTACAGCTGTGCCGAAGTCATACCGCTCACCCTGGGAGC
    AGGCCATTATCAACGACCCAGCATTGGCTGACACACTAATTACCCGAATGCCTCACACAAAGCCTCAAGCAGAATGTCCA
    GGATACAAGAGCTTCAACAGAGTCGCAACCCCTTTTGGTGGATTCATCAAAGCACCCCGGCCAGTTCCTGACAATCAACT
    TCAGGTGGAAACCTTCCCAGACCTCCAAGCACTTCAGGACGATGGTGGGCTACATCGACCATCCTTCAACAGATCTGCTC
    TGGGCTGGACGTCAACTGCCAGCCCAGCCGCACTCCCAACTGTTTGCCCGGAGCTTGTTCTCATCCCTGAGTCAGAAGAC
    CTTTGA

    Send to
    or


    >ENSORLG00000019473 Oryzias latipes Myozenin
    ATGGATCTCGGAAAGAAGCTCAGCACTCCAAAAGACATCATGTTGGAGGAGCTATCGCTGCTTTCCAACAGAGGCTC
    TCGCCTGTTCAAAATGCGGCAGAGGAGATCAGAGAAATACACTTTTGAGAGTATTCAAAATGAAACAAACGCGCTGCTGA
    CTAATGATATTCTAAATCGAAACAATATAGATTTTATGGTGGATCCGTCAACTCAGGGAGACCAAAATGCAAACAATCCT
    GCTTCAGATACGAGCCAAGAAAAATCAGACAGCACGGGCGTGCACAAGACCTATCACACGCCATGGGAGGAGGCCATCCT
    CAGTGACCCTGACCTCGCTGAAACCATCAAACTCAGAATGCCAGAACCAAACCCACAACCAGAGCTTCCACAGTTCAGAT
    GCTTTAATAGGGTTGCAACCCCTTATGGTGGCTTTGACAAAGGTCCCAGAGGAATCACTTTCAAGCTCCCCGAGGTGGAC
    CTGAACCTACCACGATTCCCAGAGTTGAACGAGTCAAGGATGAAGAGGCCCACCTTT

    Send to
    or


    >XM_004073472_Oryzias latipes
    ATGCAGTCGGGCCTGGGTGACGTGACAAAACAGAGGATGTTACAGGCACAAGCCCTTGCTAATGAAGCCAGAGGAGGC
    CTGAACCTGGGGAAAAAGATCAGCGTTCCAAAAGACGTGATGATGGAGGAGCTCAACCTTCCCTCCAATCGCGGCTCTCG
    CATGTTTCAGGAGAGACAGAGGAGAGTAGATAAGTTCACTCTGGAGAACGTCACCTCTGGACCTCATTACACCAATGTTC
    ACCTCGAGGCCAGTCCTCCCCAGCAGACAGTGGTGCAGCCGCAGGGAGGAAAAGAAAACCAAGCTGTCTCCATCCCCGGA
    TATTCTGGACCTTTGAAGGAAATTCCCCATGAGAAGTTTAACACAACCATAATCCCCAAATCTTACTGCTCCCCATGGAG
    GGAAGCTTTGGGAGGCAATGAGGAGCTTTTGGGTCTCCTAAACACACAGCTGCCACAGCCCCCACAAAAACTACAGCCTG
    CCAACTACAGGTGTTTTAACAGGTCTCCGATGCCATTTGGGGGCTCTACGGCAAGCAGGAGAGTGATCCCAGTCATTTCC
    TTTGAGGCAGTGGCGTCCCAGAACCTTCCCAACGTCTCTATGGACCACATGTGTCGACGGCCCAACTTCAACAGAGCTCC
    CAGGGGATGGGGAGGGAACTACAGCCCGGAATCAAATGAACTATGA

    Send to
    or




    Organism

    Phylogeny (Gene Tree)

    Paralogs

    Sequencing Methods

    Citations

    Sequence


    Data input by Mara Iliopoulou

    CLICK IMAGES
    FOR LARGER SIZE