Home BLAST Help About  

otx2 (Homeobox Protein otx2)

Organism
Salmo salar (Atlantic salmon)
Phylogeny
Paralogs
otx2-a,
Sequencing Methods
otx2-a: Illumina sequencing, TSA database

otx2-b: Illumina sequencing, TSA database
Citations
  • Heather D. Veilleux, Lynne Van Herwerden, Nicholas J. Cole, Emily K. Don, Christian De Santis, Danielle L. Dixson, Amelia S. Wenger, Philip L. Munday. (2013). Biology Open 2:907-915. doi:10.1242/‚Äčbio.20135496.
  • fish-it.org.
  • Sequence >GBHC01011108.1 Salmo salar otx2-a
    ATGATGTCTTATCTGAAGCAGCCACCTTATACAGTCAACGGCCTGAGTTTGTCTGCTTCCGGGATGGACCTACTTCATCC
    GTCTGTCGGCTATCCAGCCACCCCTCGTAAACAGAGGCGCGAGAGGACGACCTTTACGCGTGCTCAGCTGGACATTCTGG
    AGAACTTGTTCGCCAAGACGCGCTACCCAGACATCTTCATGCGCGAGGAGGTGGCCCTGAAGATCAACCTACCTGAATCT
    CGTGTTCAGGTATGGTTTAAAAACCGAAGGGCGAAGTGTCGCCAGCAGGCACAGCAGTCACAGAGCGGCGCACAGAGCAA
    GACCAGACCCGTCAAGAAGAAAAGTTCCCCCATCAGAGAAGCCAGCTCCGAGAGCGGTGCCAGCGGCCAGTTCACACCGC
    CCCCCAGCACCTCAATTCCCGCCGTGAGCAGCAGCAGTGCCCCGGTGTCCATCTGGAGCCCGGCCTCCATCTCTCCTCTC
    TCTGACCCACTCTCTACCTCTTCCTCCTCTTGTATGCAACGGTCGTACCCGATGACCTACACCCAGGCGTCCGGATACAG
    CCAAGGCTACACCGGATCCTCATCGTATTTCAGCGGGATGGACTGCGGGATCTTACTTGGCGCCTATGCACCACCAGCTC
    TCCACGGCGGGCTCCACAATGAGCCCCATGGGCAGCAACGGGGTATCCAGCCACCTGAGCCCGCCTTCGTCCCTCTCCAC
    GCCAGGGTATGGGGCAGCGGGACTGAGCTTCAGTGGTCCCACAGACTGCCTGGATTACAAGGACCAGGCCGCGGCCTGGA
    AACTCAACTTCAACGCTGA

    Send to
    or

    >GBRB01022568.1 Salmo salar Homeobox Protein otx2-b
    CACACACACACACACACACAGTCAATAGTGAATCCATATTTAGTTCATTGATAAATGTGGGGGTCTGATCTCAGGACCTT
    TATTTATGTCTGTTCAGCGGTGGGGTCACACCATTTTTGGAGCCATGTTAGGGATCCACAATCAACGTGAGTGATCAATG
    GATAGGGACGCGCTAGGCTGTCCAGAGAGGTCTCAGCAATCGAGTTTCTTTTCCAGTATCCCCTCAGATGTTCTACCCTG
    TGTTTGGACAGTCAGGTTGTCTCTTGCAATAATCATTATTTAACCATTATCCATTCTTTTCTTGTTGTTCAAAAAGTTAC
    AAATCTATTAAAATCACAGCAGAGAGTCATCGCTGATGCGAGGGAGCTCACAAATTGCATACAATACAACAGATCACAGT
    TTCGAAGGCTAGCACAGATTTAAAAAACAAACACATATGTACCATTTATATAAGACACACACTGATTGTCTCTTAGAAAC
    TACATTTTGATTCCTTATAAACACTTTTTCTTAAATAAAGTAGTCAATCCGTGTCGCCTTGGGGGAGCGCAGTCCACACA
    ACATTCCTGGTCAAAGTGTTCCTCCGCCAATAGGTCGGCAAGTTGTAAGAGGCTTAAATGAAGCCTGTCCATCCCAAGCA
    CTTAACCAAAAGATTGGCTCCTCTAGCAATGTTGTTCTTGGGTAAGGATTTGTTCGTGGCTGTGATGTACCATAAGTTAC
    TACGAGTCGACTCCAAGTTTTCCTTCAATTAACCAACAGGTGCTGTACTGTTAGCATAGAGGTACACACTGACAGACAGA
    TGAGATGGCTTCAACCTGTGAGGTTAATGAAAATAAAATATCTTTGCCAGTGCTAAAATAAATTATAACTTCTCCTCTGC
    TGGACAGGGCCAAACTTCATGCCAACAACACGAGCCGCTACCGAGAGTCGCCCCCCCTCTCTCTTTCTCTCTCGAAGTTC
    CTTACCGGCGACACGAATAATCAGTCTTTTACGGATATATCTTATTGAAGGATGGCAGGGCTATATGTTTGATTTATCAT
    CATTATCTTCGTTTGAATAGTTTACATAGCCATATTGTTCTTTTCACAGGACTTGGAATTTCCACGATGAAGTCTGATCT
    TTATAATCCAAGCAATCGGCATTGAAGTTCAGCTTCCAGGATGCCGCTTGGTCTTTATAATCCAAGCAGTCTGCCGTGGA
    GTTGAAGCCTAGCCCCGAGGCTCCGTAGCCCTGAGTGGAGAGGGATGCAGGGGACTGGTTCAGATGGCTTGTGACGGCGT
    TGGTGCTCATAGGACTGAGTGTCGTCCCGGGGCCAGACAACTGGTGGTGCATGGGTGTAAGGTAAGAACCGCAGTCCATT
    CCGCCGAAGTATGACGTTGATCCGGCATAGCCTTGGCTGTATCCCGAGGCCTGTGTGTAGGTCATTGGGTAGGATCTTTG
    CATGCAGGAGGAGGATGTAGAAAGAGGGTCAGCCAGTGGAGAGATGGAAGCTGGACTCCAAATAGATACCGGTGCGGTGC
    TGGTAGATATGGAAGGGACTGAAGTAGTACTTGAGGGCGGTGTGAACTGGCCACTCGCCCCGCTCTCAGAGCTCGCTTCT
    CTGGCTGGAGAACTCTTCTTTTTGGCTGGTCGCACTTTGTTCTGCCCCCCGTTCTGCTGCTGCTGTTGTTGCTGGCGACA
    CTTTGCCCTTCGGTTCTTAAACCAAACCTGTACACGAGACTCTGGCAGATTGATTTTCAGTGCTACCTCCTCGCGCATGA
    ATATATCAGGATATCGAGTTTTGCCGAACAGTGCCTCTAAAACGTCAAGTTGGGCGCGTGTGAAAGTCGTCCTTTCTCGT
    CTCTGCTTGCGGGGCGTCGCTGGGTAGCCCACGGATGGATGCAGAAGGTCCATTCCGGAGGTCGTTAAGCTCAGTCCATT
    GACTGTGTAAGGTGGTTGCTTGAGATACGACATCATGCTAATGTTGGACTGGGGGGTAAAGTTGGAGAAAATGTTGAAAA
    CTGGGTAAGGCCCGTAGATGTCCTTGGTTGTTTATTGGTTCTTTTTCTCGAGGTCTCGACTTTGCCGCTGAATGCTCTCG
    ATGGTGGGCCGGAGTAGAATGTTCTTTGTCCAGTTCTTTCCTTGAATAAAATAGCTCTCTCGAAATCCTGTAATGTAAAC
    AATCAAAAGTAACTGTCGCTTTGGATATATTCGAATAAAAATACCGACACAACTTTCATCTTCAACACTTGCACCAATGT
    ATGGGATAGTGCAAAAGCGTTTATGATGGTAAAATACATGCGGTTATGATTTGTTAGTCTGTTCTGGGGAAGTTGCTGGA
    GTTGGATTTGTAGAGAGGGCTGGCCAATGAGAACGTCTGGAGGACTCGAAGCTGGGTCTGTCTCTCTCTCTCGCGGGGAG
    ATTTGCTGAGAAGCAAATGTCGCCAGCTACGCTTTGACGC

    Send to
    or




    Organism

    Phylogeny (Gene Tree)

    Paralogs

    Sequencing Methods

    Citations

    Sequence


    Data input by M.Iliopoulou E.Sarropoulou

    CLICK IMAGES
    FOR LARGER SIZE